
Cara.
Nomads-
Content Count
3,116 -
Joined
-
Last visited
Content Type
Profiles
Forums
Calendar
Everything posted by Cara.
-
^ Would sir like to try the roasted duck with stuffed bellpeppers marinated in Le Ar senic sauce? Haha@ ozone friendly. I was reading this study once that claimed cows are significant contributors to global warming.
-
LOL@white southern old ladies. Now suga, be a gentleman and get me long cold glass of sweet tea. Quite the opposite @ Ngonge.
-
Have a safe and fun trip Serenity! Val, I'm good hon. Ngonge, just for you I'd have an extra helping of cambuulo qamiirtay.
-
LOL@Val. I clicked on this topic to moan about something but you ruined it How are you love? And what is the nature of this inkaar? That he become one or that he gets stuck in an elevator with one?
-
^It's Eid Che, the man is allowed to be a little giddy with familial affection and the sugar high
-
Originally posted by NGONGE: ^^ Is there such a thing these days as a guri-joogto? I mean one that is not married. Like any other job, guri-joog requires experience and one's CV should reflect that. Which is why I'm offering guri-joog internships for any ladies who want to pad their resumes (unpaid of course, otherwise that would defeat the whole purpose)
-
I guess people like the juxtaposition of innocence and debauchery. There was this show about child beauty pageants on TLC the other day that I caught the tail end of. I thought Little Miss Sunshine was exaggerating the beauty pageant world, but boy did that show convince me otherwise! Some crazy mothers in this world...
-
^ Prove that GG doesn't have two fathers. Otherwise the belief that she has two fathers is as valid as the belief that she has a mother and a father.
-
GJ, us Two Percenters are the Ralph Naders of the SOL political landscape No chance we'll even get close, but we prevent the heavy hitters from hitting it out of the park. Unless a candidate wins 51% of the total vote, I think there should be runoff elections. Ibti what do you say? Note to the front-runners: If you want my support during the run-off elections, send me a care package filled with designer goodies
-
OK GG, I think I see where the confusion stems from. When a biologist says "mutation", they don't mean you suddenly have extra toes or no liver or you can shoot spider webs out of your wrists. A mutation is ANY change in your genetic make-up. To say that "DNA changes, and sometimes these changes result in mutation" is sort of like saying "Birds fly, and sometimes this flying results in wings". Birds fly because they have wings, DNA changes because there's a mutation. Let's look at a simple example. You have a gene for making an enzyme called SOL hydrogenase. This is an important enzyme that lets you click on and reply to topics on SOL. The enzyme is active in the finger tips and the cornea of the eyes. The gene for SOL hydrogenase is in chromosome 13. You have two chromosome 13's, one you inherited from your father and one you inherited from your father. Now the SOL hydrogenase gene is very short, only 20 base pairs of DNA: AAAAGGGTTTCGCGAAAAAA AAA It's also very repetitive Remember it's double-stranded DNA, so the complementary sequence is TTTTCCCAAAGCGCTTTTTT TT, but for simplicity's sake let's focus on the one strand. Now almost all mammalian genes have introns, which are short sequence within a gene that don't code for a protein, they basically get snipped out during mRNA processing. The SOL hydrogenase gene has 3 intronic bases, which are in small case: AAAAGGGTTtcgCGAAAAAAAAA If there was a "mutation" in the intronic sequence such that your gene now reads AAAAGGGTTccgCGAAAAAAAAA What's the outcome for you? Almost certainly none, because the region mutated is an intron, so you still make a functional SOL hydrogenase. Now what if the mutation was in the important exonic sequence, so that you now have: AAAAGGGTTtcgCGAAAACAAAA Does this mean you can no longer post on SOL? No, not really. Because you have two copies of the gene (one from dad, one from mom), the non-mutated gene can pick up the slack. Or maybe the mutation happened in your pancreas, where you don't even need the gene. Or really, it only happened in one cell, so only that cell will be not making SOL hydrogenase. The bottom line is that even these "changes in the genetic make-up" are called mutations because that's what they are. Alright. Final bit of reminder. Remember at conception you start out as a single fertilized cell which then divides many many times to make a fully developed fetus, and then many more cell divisions later you're a full grown adult. As an adult you have approximately 50 trillion cells in your body (50000000000000) so obviously there has been many many cell divisions over that time. If mutations happen even 1 in 10,000 DNA bases, and you have 3 billion bases of DNA per cell, and 50 trillion cells per person, you are talking about a fair number of mutations over time. Whether it's a critical mutation depends on when in happens (early on as the fetus is generating the first cell of an organ, or later when you have million of other cells per organ), where it happens (introns vs exons, in the right organ or in an irrelevant organ, etc) and whether you have another good copy of the gene that will hopefully pick up the slack. quote: What is the process by which bacteria and viruses become resistant to antibiotics/antivira ls? This is irrelevant. Mutation is rare - an exception and not the rule. I don't follow how that's irrelevant. Antibiotic resistance is a classic example of a beneficial mutation (well, beneficial for the bacterium, not for us), and here you seem to be arguing that mutations do not happen and if they do they signify that something has gone terribly wrong. Could you explain how antibiotic resistance fits in your paradigm?
-
^Have you ever heard of DNA fingerprinting? If you and your older sibling were the only suspects in a crime, would it be possible to distinguish between the two of you based on a DNA sample found at the scene of the crime? What about you and your mother or father? You and your identical twin sibling? You and the Dalai Lama? Or would that be only possible if the two of you are "retards" or have a genetic disorder? Are all mutations deleterious? Is it possible to have a mutation that's beneficial to an organism, or a mutation that is neutral? Ever heard of a "silent mutation"? What is the process by which bacteria and viruses become resistant to antibiotics/antivira ls?
-
Sorry Ngonge, Val's quip really knocked the wind out of that little anecdote Hello trollers! Nuune, I went swimming last night; do you consider dabaal proper jimicsi?
-
^Better yet, try Somali Pirates 14% Negative 83.7% Positive 2.3% Don't Care Conclusion: The internet is mainly positive on the subject of Somali pirates, according to Google.
-
^Waiting? Pffft, no such passiveness from me. Does anyone know where one may procure arsenic? And does anyone know what type of food KK, Val, Serenity et al. like? Box of chocolates? Baklava? Cheesecake? Sorry for getting off topic.
-
^LOL. I don't think she knows either Cynical, just scrape off the top and dig in. That's what I do.
-
LOL @ Ngonge. Banooni! Jiriin! Ari carbeed! Xambaar! *looks around room wildly* Miis! tarmuus! Koob! Mukulaal!
-
Ngonge, adiga babiska dhig bal waxba kuuma tarayee. You forgot to put a dhimbicil in the dhuxul Hello Juxa, don't listen to Ngonge, your presence always brightens up the troll corner Ducaysane, next time you see her look pointedly at her attributes and say "wow, it sure is cold in here huh?" Ibti adiga ibtila tahay. Can you get a delivery?
-
^As usual Alle-Ubaahne xoogaa wuu khafiifaa when he hears certain trigger words.
-
When did Alle-Ubaahne show up?? I got my eid gift early I see *Waves @ Val. How's it going love?
-
Dear Admin, I would like to request that several PMs I've sent to someone be deleted immediately. It appears that the recipient was not able to view the PMs or respond, and may thus have the wrong impression if they were to access the set of messages all of a sudden. In particular, I would like to delete: PM #1 Hi Marx! Ur so cute. lol. PM #2 Hi Marx! I really like U! Wat's ur name? PM #3 Hi Marx! i didn't get a msg from u yet. waiting! :heart: :heart: :heart: PM #4 Hi Marx! Oooh u're playing hard to get! That's cool, i guess you must get a lot of girls on SOL sending you messages PM #5 Come on cutie pie, it wouldn't hurt you to say hi back PM #6 Just so you know, I've also been sending messages to Nin-Yaaban and he was nice enough to at least say hi back! But I'll start ignoring him if you reply soon, last chance! PM #7 What the hell Marx, I thought we had something special. I guess PM#2 meant nothing to you! PM #8 Marx, I'm crying into my pink frilly hankerchief that I embroidered your name into. Don't you like me anymore? PM #9 Marx, I'm suing you for emotional abuse. I hope you fall into a pit of poisonous snakes and hungry scorpions! You can't do this to me! You are hateful and ignorant and I never liked you anyway! I cannot believe I almost stabbed someone for saying you were a little chubby after the holiday season! I hate you! I'm tearing up the photo album I made of us! Even the little pictures I made of how our babies would look like are going in the fire! PM #10 Mr. "Marx", this is Arac's psychologist Dr. Weinberg, please reply to this message at your earliest convenience. It appears that my patient has developed a psychosomatic illness triggered by hearing the letters A, M, R, and X. We have looked through her records and found your pen name and photos of Winston Churchill's face Photoshopped on little black babies, so we have reason to believe she may have become fixated on your online persona. If you care at all about the mental well-being of a fellow Somali, as unstable as she may be, please reply to the following email as soon as possible.
-
^Indeed it's pretty. You probably checked out graphic novels the last time you were on Amazon, do you read them a lot?
-
Hello trollers. I have this overwhelming urge to buy a gadget today, but my budget won't allow so much as a stapler The Amazon Kindle is whispering sweet nothings to me, but I shouldn't pay attention. At least not until they develop color e-ink Oh but what nerd hasn't grown up waiting for the Hitchhiker's Guide to the Galaxy?
-
^Hehe. Those aren't teeth. They are serrations in the mandible, and made of keratin rather than bone. Do you notice the distinct lack of gums? I was expecting something more like this
-
^That's endearing C&H. Hopefully your aunts are still not arguing Happy belated birthday Indho Blue! Norfsky, cross my heart and hope to die.